Molecular Basis of Inheritance — Practice Questions

Free NEET Biology multiple-choice questions on Molecular Basis of Inheritance. Attempt each question and reveal the answer with a full explanation.

Which one of the following makes use of RNA as a template to synthesize DNA - DNA dependant RNA polymerase DNA polymerase Reverse transcriptase RNA polymerase The segment of DNA which acts as the instrument manual for the synthesis of the protein is : Nucleoside Nucleotide Ribose Gene What is not true for genetic code? It is unambiguous A codon in mRNA is read in a non-contiguous fashion It is nearly universal It is degenerate Removal of introns and joining the exons in a defined order in a transcription unit is called : Capping Splicing Tailing Transformation Semiconservative replication of DNA was first demonstrated in : Salmonella typhimurium Drosophila melanogaster Escherichia coli Streptococcus pneumoniae Point mutation involves : Deletion Insertion Change in single base pair Duplication The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C (1) A-transcription, B-replication, C-James Watson (2) A-translation, B-transcription, C-Erevin Chargaff (3) A-transcription, B-translation, C-Francis Crick (4) A-translation, B-extension, C-Rosalind Franklin Transformation was discovered by :- Meselson and Stahl Hershey and Chase Griffith Watson and Crick Select the correct option :- 5′—3′ ; 3′—5′ 3′—5′ ; 5′—3′ 5′—3′ ; 5′—3′ 3′—5′ ; 3′—5′ The correct statement regarding RNA and DNA, respectively is : The sugar component in RNA is arabinose and the sugar component in DNA is 2'-deoxyribose. The sugar component in RNA is ribose and the sugar component in DNA is 2'-deoxyribose. The sugar component in RNA is arabinose The sugar component in RNA is 2'-deoxyribose and the sugar component in DNA is arabinose. A complex of ribosomes attached to a single strand of RNA is known as :- Polysome Polymer Polypeptide Okazaki fragment Nucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by - Base-sugar-OH Base-sugar-phosphate Sugar-phosphate (Base-sugar-phosphate) n Which one of the following is the starter codon ? (1) AUG (2) UGA (3) UAA (4) UAG A complex of ribosomes attached to a single strand of mRNA is known as: Okazaki fragment Polymer Polyribosome Polypeptide A couple claimed in court that a child belonged to them. Their claim can be true if the DNA fingerprint pattern of the child shows. 50% bands similar to father and 50% similar to mother DNA fingerprint pattern 100% similarity to both the parents DNA fingerprint as both contribute equally to zygote formation 100% similarity to mother’s DNA print because of maternal inheritance. 100% similarity to father’s DNA print due to large number of mitochondria in sperm The technique of DNA fingerprinting, is superior to conventional fingerprinting because it can: Be generated more rapidly, and is inexpensive Generate unique fingerprints for each finger Compare the whole DNA sequence of two individuals Differentiate between polymorphic DNA sequences among individuals The experimental proof for semiconservative replication of DNA was first shown in a Plant Bacterium Fungus Virus AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA? ACCUAUGCGAU UGGTUTCGCAT AGGUAUCGCAU UCCAUAGCGUA Purines found both in DNA and RNA are (1) Cytosine and thymine (2) Adenine and thymine (3) Adenine and guanine (4) Guanine and cytosine Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology? (1) Genetic code is specific (2) Genetic code is not ambiguous (3) Genetic code is redundant (4) Genetic code is nearly universal Name the enzyme that facilitates opening of DNA helix during transcription. DNA helicase DNA polymerase RNA polymerase DNA ligase Which of the following statements is correct? Adenine pairs with thymine through one H-bond Adenine pairs with thymine through three H-bonds Adenine does not pair with thymine Adenine pairs with thymine through two H-bonds Which one of the following hydrolyses internal phosphodiester bonds in a polynucleotide chain- Lipase protease Exonuclease Endonuclease The first phase of translation is Recognition of DNA molecule Aminoacylation of tRNA Recognition of an anti-codon Binding of mRNA to ribosome Complete the flow chart on central dogma. (a)-Translation; (b)-Replication; (c)-Transcription;(d)-Transduction (a)-Replication; (b)-Transcription; (c)-Translation; (d)-Protein (a)-Transduction; (b)-Translation; (c)-Replication; (d)-Protein (a)-Replication; (b)-Transcription; (c)-Transduction; (d)-Protein What is the role of RNA polymerase III in the process of transcription in eukaryotes? Transcribes tRNA, 5s rRNA and snRNA Transcribes precursor of mRNA Transcribes only snRNAs Transcribes rRNAs (28S, 18S and 5.8S) DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as Repetitive DNA Single nucleotides Polymorphic DNA Satellite DNA If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it? T : 20 ; G : 20 ; C : 30 T : 30 ; G : 20 ; C : 20 T : 20 ; G : 25 ; C : 25 T : 20 ; G : 30 ; C : 20 Which of the following RNAs is not required for the synthesis of protein? tRNA rRNA siRNA mRNA Which one of the following statements about Histones is wrong? The pH of histones is slightly acidic Histones are rich in amino acids - Lysine and Arginine Histones carry positive charge in the side chain Histones are organized to form a unit of 8 molecules Read the following statements and choose the set of correct statements : (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octomer is wrapped by negatively charged DNA in nucleosome (d) Histones are rich in lysine and arginine (e) A typical nucleosome contains 400 bp of DNA helix Choose the correct answer from the options given below : (a), (c), (d) Only (b), (e) Only (a), (c), (e) Only (b), (d), (e) Only The process of translation of mRNA to proteins begins as soon as : The larger subunit of ribosome encounters mRNA Both the subunits join together to bind with mRNA The tRNA is activated and the larger subunit of ribosome encounters mRNA The small subunit of ribosome encounters mRNA Unequivocal proof that DNA is the genetic material was first proposed by Frederick Griffith Alfred Hershey and Martha Chase Avery, Macleoid and McCarthy Wilkins and Franklin Telomerase is an enzyme which is a - RNA Ribonucleoprotein Repetitive DNA Simple protein A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end; Repressor, Operator gene, Structural gene Structural gene, Transposons, Operator gene Inducer, Repressor, Structural gene Promotor, Structural gene, Terminator Which of the following statement is correct regarding the process of replication in E.coli? (1) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3' 5' (2) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' 3' (3) The DNA dependent DNA polymerase catalyses polymerization in 5' 3' as well as 3' 5' direction (4) The DNA dependent DNA polymerase catalyses polymerization in 5' 3' direction Who proposed that the genetic code for amino acids should be made up of three nucleotides? Franklin Stahl George Gamow Francis Crick Jacque Monod Histones are enriched with - Phenylalanine & Arginine Lysine & Arginine Leucine & Lysine Phenylalanine & Leucine Which one of the following disorders is caused by the substitution of Glutamic acid (Glu) by Valine (Val) at the sixth position of the beta globin chain of the haemoglobin molecule? Phenylketonuria Haemophilia Sickle-cell anaemia Thalassemia The sixth mutant codon of beta globin gene causing polymerization of Haemoglobin and change in RBC shape is . CAG AUG GUG GAG Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originates as adaptation. These imprints need to be used - On plates with and without streptomycin Only on plates with streptomycin On plates with minimal medium Only on plates without streptomycin Genes for cytoplasmic male sterility in plants are generally located in - Nuclear genome Chloroplast genome Cytosol Mitochondrial genome Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis ? Erythromycin Neomycin Streptomycin Tetracycline Antiparallel strands of a DNA molecule means that- One strand turns anti-clockwise The phosphate groups of two DNA strands, at their ends, share the same position The phosphate groups at the start of two DNA strands are in opposite position (pole) One strand turns clockwise Amino acid sequence, in protein synthesis is decided by the sequence of- tRNA mRNA cDNA rRNA The okazaki fragments in DNA chain growth polymerize in the 3’ - to - 5’ direction and forms replication fork prove semi-conservative nature of DNA replication polymerize in teh 5’ - to - 3’ direction and explain 3’ - to - 5’ DNA replication result in transcription. Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a "triplet" ? Beadle and Tatum Nirenberg and Mathaei Hershey and Chase Morgan and Sturtevant Sickel cell anemia is : Characterized by elongated sickle like RBCs with a nucleus An autosomal linked dominant trait Caused by substitute of valine by glutamic acid in the beta globin chain of haemoglobin Caused by a change in a single base pair of DNA Which of the following is not required for any of the techniques of DNA fingerprinting available at present ? (1) Polymerase chain reaction (2) Zinc finger analysis (3) Restriction enzymes (4) DNA-DNA hybridization Select wrong statement: DNA stores genetic information There is now enough evidence that essential processes like metabolism, translation and splicing evolved around RNA DNA may act as a catalyst RNA can splice itself and is also able to act as a catalyst If the ratio of (T+C)/(A+G) in one strand of DNA is 1.43, same ratio in the complementary strand is: 2.10 0.35 0.70 1.43 Consider the following statments and choose the correct option : (a) Six codons do not code for any amino acid (b) Codon is read in m-RNA in a contiguous fashion (c) Three codons function as stop codons (d) The initiator codon AUG codes for methionine (1) (a) is wrong (2) (a), (b) and (d) are wrong (3) (a), (b) and (c) are wrong (4) (b), (c) and (d) are wrong Select the correct match T.H. Morgan - Transduction F 2 Recessive parent - Dihybrid cross Ribozyme - Nucleic acid G. Mendel - Transformation Under which of the following conditions will there be no change in the reading frame of following mRNA? 5’AACAGCGGUGCUAUU3’ (1) Deletion of GGU from 7th, 8th and 9th positions (2) Insertion of G at 5th position (3) Deletion of G from 5th position (4) Insertion of A and G at 4th and 5th positions respectively If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 10 9 bp, then the length of the DNA is approximately 2.5 meters 2.2 meters 2.7 meters 2.0 meters One gene-one enzyme hypothesis was postulated by- R. Franklin Hershey and Chase A.Garrod Beadle and Tatum Identify the correct statement. RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria The coding strand in a transcription unit is copied to an mRNA Split gene arrangement is characteristic of prokaryotes In capping, methyl guanosine triphosphate is added to the 3' end of hnRNA Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes? DNA dependent RNA polymerase DNA Ligase DNase DNA dependent DNA polymerase Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below. Both Statement I and Statement II are false Statement I is correct but Statement II is false Statement I is incorrect but Statement II is true Both Statement I and Statement II are true If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs? 6.6 10 9 bp 3.3 10 6 bp 6.6 10 6 bp 3.3 10 9 bp Ten E.coli cells with 15 N - dsDNA are incubated in medium containing 14 N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15 N ? 40 cells 60 cells 80 cells 20 cells What is the role of RNA polymerase III in the process of transcription in Eukaryotes? Transcription of rRNAs (28S, 18S and 5.8S) Transcription of tRNA, 5S rRNA and snRNA Transcription of precursor of mRNA Transcription of only snRNAs Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is correct but Statement II is false. (4) Statement I is incorrect but Statement II is true. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’? 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’ 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’ 5’ ATCGATCGATCGATCGATCGATCGATCG 3’ 3’ ATCGATCGATCGATCGATCGATCGATCG 5’ Match List I with List II array ll List I & List II A. Frederick Griffith & I. Genetic code B. Francois Jacob & Jacque Monod & II. Semi-conservative mode of DNA replication C. Har Gobind Khorana & III. Transformation D. Meselson & Stahl & IV. Lac operon array Choose the correct answer from the options given below: A-III, B-II, C-I, D-IV A-III, B-IV, C-I, D-II A-II, B-III, C-IV, D-I A-IV, B-I, C-II, D-III Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA 5' 5' AUGUACCGUUUAUAGGUAAGU 3' 5' AUGUAAAGUUUUAUAGGUAAGU 3' 5' AUGUACCGUUUUAUAGGGAAGU 3' 5' ATGTACCGTTTTATAGGTAAGT 3' One turn of the helix in a B-form DNA is approximately- 20 nm 0.34 nm 3.4 nm 2 nm Match List I with List II: array llll ; & List I & ; & List II A. & RNA polymerase III & I. & snRNPs B. & Termination of transcription & II. & Promotor C. & Splicing of Exons & III. & Rho factor D. & TATA box & IV. & SnRNAs, tRNA array Choose the correct answer from the options given below : (1) A-II, B-IV, C-I, D-III (2) A-III, B-II, C-IV, D-I (3) A-III, B-IV, C-I, D-II (4) A-IV, B-III, C-I, D-II Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II : DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below : Statement I is incorrect but statement II is correct Both statement I and statement II are correct Both statement I and statement II are incorrect Statement I is correct but statement II is incorrect Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5’ end of hnRNA. D. Addition of adenine residues at 3' end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below : C, D, E only A, B, C only B, C, D only B, C, E only Match List I with List II: array llll ; & List-I & ; & List-II A. & Alfred Hershey and Martha Chase & I. & Streptococcus pneumoniae B. & Euchromatin & II. & Densely packed and dark-stained C. & Frederick Griffith & III. & Loosely packed and light-stained D. & Heterochromatin & IV. & DNA as genetic material confirmation array Choose the correct answer from the options given below: A-III, B-II, C-IV, D-I A-II, B-IV, C-I, D-III A-IV, B-II, C-I, D-III A-IV, B-III, C-I, D-II Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR probe. C. Transferring of separated DNA fragments to synthetic membranes. D. Detection of hybridised DNA fragments by autoradiography. E. Separation of DNA fragments by electrophoresis. Choose the correct answer from the options given below : A, E, B, C, D A, D, B, E, C A, B, D, C, E A, E, C, B, D Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator. B. The promoter is said to be located towards the 5'-end of the structural gene. C. The promoter is a DNA sequence that provides binding site for RNA polymerase. D. The promoter defines the template and coding strands. E. The terminator is located towards the 3'-end of the coding strand and it defines the end of the process of transcription. Choose the correct answer from the options given below : B, C, D and E only A, B, C, D and E A, B, C and D only A, C, D and E only Which of the following statements are correct with reference to packaging of DNA helix ? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins. Choose the correct answer from the options given below : B, D and E only A, B and D only C, D and E only A, C and E only Which of the following enzymes synthesizes precursor mRNA? RNA polymerase I RNA polymerase II RNA polymerase III DNA polymerase The length of DNA molecule greatly exceeds the dimensions of the nucleus in eukaryotic cells. How is this DNA accommodated? super-coiling in nucleosomes DNase digestion through elimination of repititive DNA deletion of non-essential genes. The two polynucleotide chains in DNA are discontinuous antiparallel semiconservative parallel.